Mark nucleotied-count as foregone. (#3617)

config.json

@@ -2143,15 +2143,6 @@
         "difficulty": 2,
         "status": "deprecated"
       },
-      {
-        "slug": "nucleotide-count",
-        "name": "Nucleotide Count",
-        "uuid": "105f25ec-7ce2-4797-893e-05e3792ebd91",
-        "practices": [],
-        "prerequisites": [],
-        "difficulty": 2,
-        "status": "deprecated"
-      },
       {
         "slug": "binary",
         "name": "Binary",
@@ -2234,7 +2225,7 @@
         "status": "deprecated"
       }
     ],
-    "foregone": ["lens-person", "parallel-letter-frequency"]
+    "foregone": ["lens-person", "nucleotide-count", "parallel-letter-frequency"]
   },
   "concepts": [
     {

exercises/practice/nucleotide-count/.docs/instructions.md

@@ -1,23 +0,0 @@
-# Instructions
-
-Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
-All known life depends on DNA!
-
-> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
-
-DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
-A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
-We call the order of these nucleotides in a bit of DNA a "DNA sequence".
-
-We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
-'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
-
-Given a string representing a DNA sequence, count how many of each nucleotide is present.
-If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
-
-For example:
-
-```text
-"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
-"INVALID" -> error
-```

exercises/practice/nucleotide-count/.meta/config.json

@@ -1,32 +0,0 @@
-{
-  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
-  "authors": [],
-  "contributors": [
-    "behrtam",
-    "cmccandless",
-    "Dog",
-    "ikhadykin",
-    "kytrinyx",
-    "lowks",
-    "mostlybadfly",
-    "N-Parsons",
-    "Oniwa",
-    "orozcoadrian",
-    "pheanex",
-    "sjakobi",
-    "tqa236"
-  ],
-  "files": {
-    "solution": [
-      "nucleotide_count.py"
-    ],
-    "test": [
-      "nucleotide_count_test.py"
-    ],
-    "example": [
-      ".meta/example.py"
-    ]
-  },
-  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
-  "source_url": "https://rosalind.info/problems/dna/"
-}

exercises/practice/nucleotide-count/.meta/example.py

@@ -1,18 +0,0 @@
-NUCLEOTIDES = 'ATCG'
-
-
-def count(strand, abbreviation):
-    _validate(abbreviation)
-    return strand.count(abbreviation)
-
-
-def nucleotide_counts(strand):
-    return {
-        abbr: strand.count(abbr)
-        for abbr in NUCLEOTIDES
-    }
-
-
-def _validate(abbreviation):
-    if abbreviation not in NUCLEOTIDES:
-        raise ValueError(f'{abbreviation} is not a nucleotide.')

exercises/practice/nucleotide-count/.meta/tests.toml

@@ -1,18 +0,0 @@
-# This is an auto-generated file. Regular comments will be removed when this
-# file is regenerated. Regenerating will not touch any manually added keys,
-# so comments can be added in a "comment" key.
-
-[3e5c30a8-87e2-4845-a815-a49671ade970]
-description = "empty strand"
-
-[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
-description = "can count one nucleotide in single-character input"
-
-[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
-description = "strand with repeated nucleotide"
-
-[40a45eac-c83f-4740-901a-20b22d15a39f]
-description = "strand with multiple nucleotides"
-
-[b4c47851-ee9e-4b0a-be70-a86e343bd851]
-description = "strand with invalid nucleotides"

exercises/practice/nucleotide-count/nucleotide_count.py

@@ -1,6 +0,0 @@
-def count(strand, nucleotide):
-    pass
-
-
-def nucleotide_counts(strand):
-    pass

exercises/practice/nucleotide-count/nucleotide_count_test.py

@@ -1,46 +0,0 @@
-"""Tests for the nucleotide-count exercise
-
-Implementation note:
-The count function must raise a ValueError with a meaningful error message
-in case of a bad argument.
-"""
-import unittest
-
-from nucleotide_count import count, nucleotide_counts
-
-
-class NucleotideCountTest(unittest.TestCase):
-    def test_empty_dna_string_has_no_adenosine(self):
-        self.assertEqual(count('', 'A'), 0)
-
-    def test_empty_dna_string_has_no_nucleotides(self):
-        expected = {'A': 0, 'T': 0, 'C': 0, 'G': 0}
-        self.assertEqual(nucleotide_counts(""), expected)
-
-    def test_repetitive_cytidine_gets_counted(self):
-        self.assertEqual(count('CCCCC', 'C'), 5)
-
-    def test_repetitive_sequence_has_only_guanosine(self):
-        expected = {'A': 0, 'T': 0, 'C': 0, 'G': 8}
-        self.assertEqual(nucleotide_counts('GGGGGGGG'), expected)
-
-    def test_counts_only_thymidine(self):
-        self.assertEqual(count('GGGGGTAACCCGG', 'T'), 1)
-
-    def test_validates_nucleotides(self):
-        with self.assertRaisesWithMessage(ValueError):
-            count("GACT", 'X')
-
-    def test_counts_all_nucleotides(self):
-        dna = ('AGCTTTTCATTCTGACTGCAACGGGCAATATGTCT'
-               'CTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC')
-        expected = {'A': 20, 'T': 21, 'G': 17, 'C': 12}
-        self.assertEqual(nucleotide_counts(dna), expected)
-
-    # Utility functions
-    def assertRaisesWithMessage(self, exception):
-        return self.assertRaisesRegex(exception, r".+")
-
-
-if __name__ == '__main__':
-    unittest.main()